Herpes Simplex Virus Oligonucleotide Probes used in the DNA-microarray
Back to Dr. Wagner's Home Page

Probe Name
kinetics ID
Transcript
Name
Sequence of Probe (17syn+) Oligo (mRNA sense)
E-1 U1/2 CAGGCCGGACCCTCGGGTCCATTGCGTCCTCAAGTTTTCGCACCCGTCGCCCCTCTCCAAGGTTCCGTTCGGAAC
? U1X GCGGCCTGCTTGCGACTGTCCAGCGCCTGGCGTATCTCTTTATAAAGGGCCAAGCGCGTTTCTGTTTCCTGGGTG
L-1 U3 AGTTCGTCTCGTCCGAGCCAATGCGCCTCCACCGAGATAACGTCATGCTGGCCTCGGGGGCCGAGTAACCGCCCC
E-2 U4-5' ATGTCCAATCCACAGACGACCATCGCGTATAGCCTATGCCACGCCAGGGCCTCGCTGACCAGCGCACTGCCCGAC
E-3 U4/5 CGCCTCCACCCCCGACAACCGCCTGCCCCGGGACGGCCGAGTTTCTCCAGCCCACCGCGGACCTGCTGGTAGAGG
L/? U6/7 GGATCATGGGGAGCTGCTGGGCGTCGGAGGAGGTGCGCGCGCCTCTGGTCTATTGGTGGCTTTCGGAGACCCCAA
E-4 U8/9 CGTCCCCGTCGATCTATACCCGCGGCCCCTTGTGCTCCCCCCCGTGGACTGCGCTCATCACCTGCGCGAAATCCT
E-5 U8-5' AGACCGGGCCGGTGGCCCTGTTCGCCCCGCTGCGTATCGGCTCGGACCCACGCACGGGACTGGTGGTGAAAGTTG
L-2 U10 GACGATCCCATCTATGACACCGTTGGGGGGTACGACCCCGAGCCCGCCGAGGACCCCGTGTACAGCACCGTCCGC
L/E/L U11/14 TCTCCTGGGGGCACCCACGCCCGCGACCCGGACGCCGATCCCGACTCCCCGGACCTTGACTCTATGTGGTCGGCG
L-4 U15 TTATGGCCATCTACCTCGCGGCCCAGGCCGGACCTCCGCACACATTCGCTCCTATCACACGCGTCTCGTGAGCGCC
L-3 U16/17 GTCCGCTTCTCTTTGGCCATCCCGTGGATACGGTCACCCTGCTGCAGGCCCCCCGCCGTCCTTGCATCACGGACC
L-5 U18/20 CTGCTGGCGGACGTCCAACAACTCGGTCCCGTAAACGCCGAGCTGCGATCGCTGGTCCTTAACATGGTTTACTCG
L-6 U19/20 CCGACATCGCCGCCAAACATCGCTGCCTGGAGCGCCTGATCGTGGAGACGGGTTCGGCGGTGTCCACGGCCACCG
L-7 U19-5' GCGTACAGTTCGAGGTCCACCAGCCGCTGATTGCCCGCGACGGCCCGCACCCCATCGAGCAACCCACACACAATT
L-8 U21 GGGCCGCCGGGTACCTGGATGTGCTTCTTACCGTTCGTCTCGCTCGCTCCCAACACGGACAGTCTGTGTAAAAGA
L-9 U22 GTTTCTGGCCGCCTCTGCGCTGGGCGTGGTTATGATTACCGCCGCCCTGGCTGGCATCCTAAAGGTTCTCCGGAC
E-6 U23 CGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCAC
L-10 U24 GAAGACTCATTTGGATCCGGCGGGAGCCACCCGACAACAGCCCCCGGGTTTTCCCACGCCAGACGCCGGTCCGCT
L-11 U(24)/25/26 TCCCCCCCGCCGCCACCGGATCCCAACCGGAGGCATCCAACGCGGAGGCCGGGGCCCTTGTCAACGCCAGCAGCG
E-7 U27/8 TGCGCAAGCGCCGCAACACCAACTACACCCAAGTTCCCAACAAAGACGGTGACGCCGACGAGGACGACCTGTGAT
E-8 U27-5' CCCTGCCACTCCGGCGCCGCCCGCCCCTGGCGCCCCCCCAACGGGGGACCCGAAACCGAAGAAGAACAGAAAACC
E-9 U29 CCCCCGACAAAAAGGGAGACCTGACGTTGGATATGCTGTGAGGGGTTGGGGGGTGGGGGAACCTAGGGCGGGGCG
E-10 U30 CTGGTGTCCGAGCTGGCCGAGGATCCCGCATACGCCATTGCCCACGGCGTCGCCCTGAACACGGACTATTACTTC
L-12 U31/32 AGCGCCGGCACCCACCGCCCCGAACCCTGCGGTCCGGAGCCGCGCGGCCACGTCGTCCGGGGGGTGCCACACTTC
L-13 U33/34/35 CCGCGTTTGGCCTGCGGCGCACCTATTCACCGTTTGTCGTTCGAGAACCTTCGACGCCCGGGACCCCGTGAGGCC
E/L U36 GCCGGGCGCTGCTTCATCACAGCGACGCCGTGCTGACCAGCCTACATCACGTGCGCATGTTACTGGGCTAGACGC
L-14 U37 CGACGCCGGAAACAGTCTCCCCGCGCCTATGCCCATGGACGCACAGAAGCCGGAGGCCTATGGGCACGGCCCACG
L-15 U38 AAACGCCCCGCCCACACAACGCTCCGCCCCCAACCCCTTCCCCGCTGTCACTCGTTGTTCGTTGACCCGGGCGTC
E-11 U39-5' TGACGGAAAGGCTTCGCGAGCACGAAGCCCAGCTGGTGATCCTGGCCCAGGCTCTGGACCATTACGACTGTCTGA
E-12 U39/40 CCCCGACGCCAGCTTTCCGCTGAGCCTCATGTCCACCGACAAACACACCAATTTTTTCGAGTGTCGCAGCACCTC
L-16 U41 AAGGACGTCCTGGCCAAATTCTGGGACGAGTAGCCCAAACGTCAGACGAGCGCGCTTGTCCCCGAACAAACGACC
L-17 U42 GGCCCGTCCCGCCGCTCCAGACGCCCGGAGCGGAAGCCGTTACGCGTGTTACTTTCGCGACCTCCCGACCGGAGA
L-18 U43 GCGGCGACGCTTCGGGGCCTCTTCTTCTCCGTGTACGCGCTGGGGTTTGGGGTGGGGGTGCTGCTGTGCCCTCCG
? U43.5-5' CCGACGGCGAACGCCCCAGACGCGGCATTCGCGTACGGCCCGCGCGACATAACGACCGATCCCGCAAAACCCAGC
L-19 U44-5' CACATCGGGGTCCCCCGGGTCAGCCGCCAGCCCGGAGGTCACCCCCACATCGACCCCAAACCCCAACAATGTCAC
L-20 U44/45 GCGCTGGGGCTGCCGTGAGGCGCGTGTACTGCGGTCTGTCTCGTCTCCTCTTCTCCCCTTCCCTCCCCCTCCGCA
E-13 U46/47 CGCCCCCGCCGTTGAGCCCCTCGCCCGTCCTCGCCCGCCATCGAGCCAACGCCCTGACCAACGACGGCCCGACCA
L-21 U48 AGTACGGTGGGTAGGGGGCGCGACCGGACCCGCATCCCCCGTCTGGGTTTTCCCCTCCCGTCACCGGTTCGTATC
E/L U49 ACCGAGCGACCTCGAGCCCCAGCCCGCTCCGCTTCTCGCCCCAGACGGCCCGTCGAGTGAAAACTTCCGTACCCA
E-14 U50 TCACGGGACCAAAGCGCTTCGAAACTACCCCAGGGGTGTTCCGGACTCAACCGCCGAACCCAGGAACCCGCCGCT
L-22 U51 TCCGTTCCCAGACCTACAGCCTCCCCAACCGCACCTCGCCCTGGCCCATCTCGAGCAGCTCCGTGTGTTTTGGGT
E-15 U52-5' ACGCTATACGTCCACCACGAGGTGCGCGTGCTTGCCGCGTACCGCAGGGCGTATTATGGAAGCGCGCAGAGTCCC
E/L h U52/53 CCCCCGAGGCCACGTGTAGCCTGGATCCCAACGACCCCGCCCATGGGTCCCAATTGGCCGTCCCGTTACCAAGAC
IE-1 U54 f TCTGCGAGTTGACGGCCAGTCACATCGTCGCCCCCCCGTACGTGCACGGCAAATATTTTTATTGCAACTCCCTGT
E-16 U55 ACCACTGCCACTGTCGGTATCCGTTCTCAAAAACATGCTGGATGGGGGCCTCCGCGGCCCTACAGCACCTGCGCT
L-23 U56 CGGCTCGTCTGATCATGCCCCATACCGGCGACAGGGCTGTTGTGGCGTGGTGTGGCGCCATGCTGTATTTGGGGT
L-24 RLXY GCGCCGGTCCATTAAGGGCGCGCGTGCCCGCGAGATATCAATCCGTTAAGTGCTCTGCAGACAGGGGCACCGCGCC
L-25 RLX GGCCACCGCCGCCCACCCACCCACCTCGGGATACCCAGCCCCGGTCCCCCGTTCCCCGGGGGCCGTTATCTCCAG
LT-1 RLAT-5' AGGGGCCCCGGCCCGGGGCCCCACAACGGCCCGGCGCATGCGCTGTGGTTTTTTTTTCCTCGGTGTTCTGCCGGG
LT-2 RHA6 GTAGTTAACCCCCCCCGCCCTTTGTGGCGGCCAGAGGCCAGGTCAGTCCGGGCGGGCAGGCGCTCGCGGAAACTT
LAT RLAT-I CTATGCTTGGGTCTTACTGCCTGGGGGGGGGGAGTGCGGGGGAGGGGGGGTGTGGAAGGAAATGCACGGCGCGTG
IE-2 RICP0 TCGACCAGGGCACCCTAGTGGGCGCCCTGGACTTCCGCAGCCTGCGGTCTCGGCACCCGTGGTCCGGGGAGCAGG
? ROP GGTGGTCTCTGGCCGCGCCCACTACACCAGCCAATCCGTGTCGGGGAGGGGAAAAGTGAAAGACACGGGCACCAC
? ROP GAACAAGAAGGCGGGGGCCCACCGGCGGGGGGCGGCGGCGGGGCGGCCGCGGGCGCGCTCCTGACCGCGGGTTCC
L-26 RICP34.5 TCGGGGGCGGGACTGGCCAATCGGCGGCCGCCAGCGCGGCGGGGCCCGGCCAACCAGCGTCCGCCGAGTCTTCGG
LT-3 RLATX ATCCACCACACCTGCCCAACAACACAACTCACAGCGACAACTCACCGCGCAACAACTCCTGTTCCTCATCCACAC
LT-4 RLAT-3' ATCCAAACCCTCCGGGGGCGCCCGCGCACCACCACCGCCCCTCGCCCCCTCCCGCCCCTCGCCCCCTCCCGCCCC
IE-3 RICP4 AACTCACAGCGACAACTCACCGCGCAACAACTCCTGTTCCTCATCCACACGTCACCGCGCACCTCCCGCTCCTCC
IE-4 R/S22 TGCCGGAAAATGCGCTTCTCCACCGCCTGCCCCTATCCGTGCAGCGACACGTTTCTCCGGCCGTGAGTCCGGTCG
E-18 US2 GCGTCCGTGTTGTGCGTGTATGGGCATGCCCGAGGTCCCAGACGAGCAACCCACATCGCCGGGCCGTGGTCCGCA
L? US3-5' CAAACCCCACCCAGCTACCCCAGGCCCCCTTACGACGTCCCATCCGGTGCGGCGTCCGTGTTGTGCGTGTATGGG
E/L? US3/4 TGTGGCGGTTGGTCCAGACGCGGGCGACGCACACACCCTAGCGTGCGTTACGTGTGCCTGCCGTCCGAACGCGGG
E-19 US5-5' GGGGGGCTTTGCCGTCCCCCTCGTAGTCGGTGGGCTGTGCGCCGTAGTCCTGGGGGCGGCATGTCTGCTTGAGCT
EL/E/E h US5/6/7 GCTTCCGACGCCCCCCGTGGACCCCACGACACCCACCCCAACGCCTCCCCTGTTGGTATAGGTCCACGGCCACTG
E-20 US8-5' ACGCCTCCCCTGTTGGTATAGGTCCACGGCCACTGGCCGGGAGCACCACATAACCGACCGCAGTCCCTGAGTTGG
E-21 US8/9 TGATCGCCTGTCTCCTCGTGGCCGTTCTGTCGGGCGGATTTGGGGCGCTCCTGATGTGGCTGCTCCGCTAAAAGA
E/E/IE h US10/11/12 CATCGACACGCGCGTCCTTCTTGTCGTCTCTCTTCCCCCCCATCACCCCGCAATTTGCACCCAGCCTTTAACTAC